Marinobacter antarcticus
Web22 apr. 2024 · Marinobacter antarcticus Liu et al. 2012: species: Marinobacter aquaeolei Nguyen et al. 1999: species: Marinobacter aquaticus León et al. 2024: species: Marinobacter aromaticivorans Cui et al. 2016: species: Marinobacter bohaiensis Xu et al. 2024: species: Marinobacter bryozoorum Romanenko et al. 2005: species: … WebMarinobacter antarcticus (Q26816888) From Wikidata. Jump to navigation Jump to search. species of Gammaproteobacteria. edit. Language Label Description Also known …
Marinobacter antarcticus
Did you know?
WebTwo Gram-negative, cold-adapted, moderately halophilic, aerobic bacteria, designated strains M3B(T) and M3T, were isolated from marine sediment collected from the South … Webname taxonomy_id taxonomy_lvl kraken_assigned_reads added_reads new_est_reads fraction_total_reads [Ruminococcus] gnavus 33038 S 7691179 616234 8307413 0.21418 [Ruminococcus] torq
WebA Gram-staining-negative, aerobic, motile, oxidase- and catalase-positive, rod-shaped strain isolated from Antarctic intertidal sandy sediment is considered to represent a … WebLe Cascate di sangue fotografate nel 2006. Le Cascate di sangue (in inglese: Blood Falls) sono il risultato della sporadica fuoriuscita di un getto di acqua salata ricca di ossido di ferro che, a partire da alcune fessure site nella parte terminale del ghiacciaio Taylor, fluisce fino ad arrivare sulla superficie ghiacciata del lago Bonney, un ...
WebRecent studies have demonstrated that heterotrophic bacteria can support prolonged Synechococcus growth by establishing metabolic mutualism for nutrient exchange (3, 7).For example, bacterial mineralization of Synechococcus-derived nitrogen-rich organic matter sustained Synechococcus sp. WH7803 growth for approximately 200 days ().Similarly, in … WebGlobal Biodiversity Information Facility. Free and Open Access to Biodiversity Data.
WebMarinobacter antarcticus strain ZS2-30 16S ribosomal RNA gene, partial sequence FJ196022 1506 GenBank. 564117 tax ID: Genome sequence information: Sequence accession description Seq. accession number Assembly level Sequence database Associated NCBI tax ID [Ref.: #66792] ...
WebRoseisalinus antarcticus Bacillus subtilis Gluconobacter frateurii Gluconobacter thailandicus 위험관리과-2648('14.8.1) Phenylobacterium haemotophilum Phenylobacterium lituiforme Phenylobacterium conjunctum. Phaeobacter leonis 위험관리과-3489('14.10.15) 위험관리과-3489('14.10.15) Penicillium chrysogenum 위험관리과-3555('14.10.20) bordirWebMarinobacter antarcticus is a Gram-negative, aerobic, halotolerant, rod-shaped and motile bacterium from the genus of Marinobacter which has been isolated from Antarctic sediments.[1][2][3] For faster navigation, this Iframe is preloading the Wikiwand page for Marinobacter antarcticus . hautkrebsscreening rostockWeb44441. 82. 7. 299. 238. 37. CTAGCATAACCCCTTGGGGCC GGAATTGTTATCCGCTCACAATTCCCCTATAG Bacillus megaterium Desulfobacterium vacuolatum DSM 3385 pET-28a(+) DSM 771 ... hautlab.com socksWebThe Antarctic marine environments for example are characterized by an average temperature of about −1 °C. This low temperature produces two main physicochemical effects: the rate of chemical reactions decreases exponentially according to the Arrhenius law and strong effect on the viscosity of the medium, thereby contributing to further slow … bord l11Web22 mei 2013 · The Marinobacter genus comprises widespread marine bacteria, found in localities as diverse as the deep ocean, coastal seawater and sediment, hydrothermal settings, oceanic basalt, sea-ice, sand, solar salterns, and oil fields. Terrestrial sources include saline soil and wine-barrel-decalcification wastewater. The genus was … bord l14WebThe glaciers in China have an important role as one of the most climate-sensitive constituents of the Tibetan Plateau which is known as the Asian Water Tower. Although the cryosphere is one of the most extreme environments for organisms, the soils of the glacier foreland harbor surprisingly rich microbiomes. A large amount of accelerated glacier … hautlaborWebMaribacter antarcticus sp. nov., a psychrophilic bacterium isolated from a culture of the Antarctic green alga Pyramimonas gelidicola. Int J Syst Evol Microbiol 2009; 59 :1455 … hautlabor gmbh